Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCATCTTTCATTTTTCCCACCCAG[A/G]CTTCCTCATTTTTTATGATTAGGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615262 MIM: 600813 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
METTL23 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
METTL23 - methyltransferase like 23 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD11 - major facilitator superfamily domain containing 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242532.1 | Intron | NP_001229461.1 | ||||
NM_001242533.1 | Intron | NP_001229462.1 | ||||
NM_001242534.1 | Intron | NP_001229463.1 | ||||
NM_001242535.1 | Intron | NP_001229464.1 | ||||
NM_001242536.1 | Intron | NP_001229465.1 | ||||
NM_001242537.1 | Intron | NP_001229466.1 | ||||
NM_024311.3 | Intron | NP_077287.1 | ||||
XM_011525236.2 | Intron | XP_011523538.1 | ||||
XM_011525237.2 | Intron | XP_011523539.2 | ||||
XM_011525238.2 | Intron | XP_011523540.2 | ||||
XM_011525239.2 | Intron | XP_011523541.2 | ||||
XM_011525240.2 | Intron | XP_011523542.2 | ||||
XM_011525241.2 | Intron | XP_011523543.2 | ||||
XM_011525242.1 | Intron | XP_011523544.1 | ||||
XM_011525244.1 | Intron | XP_011523546.1 | ||||
XM_011525247.2 | Intron | XP_011523549.2 | ||||
XM_017025065.1 | Intron | XP_016880554.1 | ||||
XM_017025066.1 | Intron | XP_016880555.1 | ||||
XM_017025067.1 | Intron | XP_016880556.1 | ||||
XM_017025068.1 | Intron | XP_016880557.1 | ||||
XM_017025069.1 | Intron | XP_016880558.1 | ||||
XM_017025070.1 | Intron | XP_016880559.1 | ||||
XM_017025071.1 | Intron | XP_016880560.1 |
MIR636 - microRNA 636 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRSF2 - serine and arginine rich splicing factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |