Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGCATGCAGGCGCCGGCGTCCTC[A/G]CTGGAGCTGTGCCCATCCACTGCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605866 MIM: 615201 MIM: 609614 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP8B3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP8B3 - ATPase phospholipid transporting 8B3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100288123 - uncharacterized LOC100288123 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1909 - microRNA 1909 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REXO1 - RNA exonuclease 1 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020695.3 | 3797 | Silent Mutation | AGC,AGT | S,S 1199 | NP_065746.3 | |
XM_011528144.1 | 3797 | Nonsense Mutation | CGA,TGA | R,* 1232 | XP_011526446.1 | |
XM_011528146.2 | 3797 | Nonsense Mutation | CGA,TGA | R,* 1197 | XP_011526448.1 | |
XM_017027028.1 | 3797 | Nonsense Mutation | CGA,TGA | R,* 1223 | XP_016882517.1 | |
XM_017027029.1 | 3797 | Silent Mutation | AGC,AGT | S,S 1208 | XP_016882518.1 | |
XM_017027030.1 | 3797 | Intron | XP_016882519.1 |