Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACAGGCTCAGCTGCATTCCCAGC[A/G]AGGCATTCCCAGAAGAGGTCACTGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 601053 MIM: 615808 | |||||||||||||||||||||||
Literature Links: |
CCDC51 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CCDC51 - coiled-coil domain containing 51 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256964.1 | 365 | Intron | NP_001243893.1 | |||
NM_001256965.2 | 365 | UTR 5 | NP_001243894.1 | |||
NM_001256966.2 | 365 | Intron | NP_001243895.1 | |||
NM_001256967.2 | 365 | Intron | NP_001243896.1 | |||
NM_001256968.2 | 365 | Intron | NP_001243897.1 | |||
NM_001256969.2 | 365 | Intron | NP_001243898.1 | |||
NM_024661.4 | 365 | Intron | NP_078937.3 | |||
XM_011534113.2 | 365 | Intron | XP_011532415.1 |
PLXNB1 - plexin B1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMA7 - translation machinery associated 7 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |