Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTGTGGGTCCTGACGGGAGGGAC[G/A]GCCTGGTCACCACTTCTGTTCACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614901 MIM: 609912 MIM: 600823 | ||||||||||||||||||||
Literature Links: |
BCKDK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCKDK - branched chain ketoacid dehydrogenase kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KAT8 - lysine acetyltransferase 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032188.2 | Intron | NP_115564.2 | ||||
NM_182958.2 | Intron | NP_892003.2 |
PRSS8 - protease, serine 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |