Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGGGTGTGCACAGCAAAGCTTCGG[C/T]CCGTGGGGCCCCGGGGTCCGCTCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614545 MIM: 615324 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ASPDH PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ASPDH - aspartate dehydrogenase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024656.2 | 772 | Missense Mutation | GAC,GGC | D,G 132 | NP_001019827.2 | |
NM_001114598.1 | 772 | Missense Mutation | GAC,GGC | D,G 237 | NP_001108070.1 |
EMC10 - ER membrane protein complex subunit 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JOSD2 - Josephin domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270639.1 | 772 | Intron | NP_001257568.1 | |||
NM_001270640.1 | 772 | Intron | NP_001257569.1 | |||
NM_001270641.1 | 772 | Intron | NP_001257570.1 | |||
NM_001270686.1 | 772 | Intron | NP_001257615.1 | |||
NM_138334.3 | 772 | Intron | NP_612207.1 | |||
XM_011526434.2 | 772 | Intron | XP_011524736.1 |
LRRC4B - leucine rich repeat containing 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |