Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATGGCGCCTGCCGCCGCTTCCCC[A/G]GAAGTTAAGTTTAAAAGTAGAAGGC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615893 | ||||||||||||||||||||||||||||||||
Literature Links: |
LOC100130394 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
LOC100130394 - translation machinery associated 7 homolog (S. cerevisiae) pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5003 - microRNA 5003 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEURL1B - neuralized E3 ubiquitin protein ligase 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |