Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTGTTGTTTTCCATCTTTGGTTTC[A/G]TTTTGTTTTAGCCACCCAACTTACA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
32 submissions
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608095 MIM: 605834 MIM: 612112 MIM: 600607 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LYSMD1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LYSMD1 - LysM domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCNM1 - sodium channel modifier 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204856.1 | Intron | NP_001191785.1 | ||||
NM_024041.3 | Intron | NP_076946.1 |
TMOD4 - tropomodulin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP8L2 - TNF alpha induced protein 8 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP8L2-SCNM1 - TNFAIP8L2-SCNM1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204848.1 | Intron | NP_001191777.1 |
VPS72 - vacuolar protein sorting 72 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |