Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGACGTTAAGGGATTTTTCGTCG[A/T]GCTTTTTTTTTTTTTTTTTTTTTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601739 | ||||||||||||||||||||
Literature Links: |
MEIS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MEIS1 - Meis homeobox 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002398.2 | 617 | UTR 5 | NP_002389.1 | |||
XM_005264321.2 | 617 | UTR 5 | XP_005264378.1 | |||
XM_005264322.2 | 617 | UTR 5 | XP_005264379.1 | |||
XM_005264323.2 | 617 | UTR 5 | XP_005264380.1 | |||
XM_005264324.4 | 617 | Intron | XP_005264381.1 | |||
XM_005264325.4 | 617 | Intron | XP_005264382.1 | |||
XM_017004141.1 | 617 | UTR 5 | XP_016859630.1 | |||
XM_017004142.1 | 617 | UTR 5 | XP_016859631.1 | |||
XM_017004143.1 | 617 | Intron | XP_016859632.1 | |||
XM_017004144.1 | 617 | UTR 5 | XP_016859633.1 | |||
XM_017004145.1 | 617 | UTR 5 | XP_016859634.1 | |||
XM_017004146.1 | 617 | UTR 5 | XP_016859635.1 |
MEIS1-AS2 - MEIS1 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MEIS1-AS3 - MEIS1 antisense RNA 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |