Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTTAATGTCCAAAGTACATTTCC[A/C]CCTTCACACTTTTGTAGGCTGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
HNRNPUL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HNRNPUL2 - heterogeneous nuclear ribonucleoprotein U like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HNRNPUL2-BSCL2 - HNRNPUL2-BSCL2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC9C - tetratricopeptide repeat domain 9C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318812.1 | Intron | NP_001305741.1 | ||||
NM_001318813.1 | Intron | NP_001305742.1 | ||||
NM_001318814.1 | Intron | NP_001305743.1 | ||||
NM_001318815.1 | Intron | NP_001305744.1 | ||||
NM_001318816.1 | Intron | NP_001305745.1 | ||||
NM_173810.3 | Intron | NP_776171.1 |