Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTGAGTAACTGCAGCCACCTGAG[A/C]CCCGGCGAGGGACAGACAGCTATGC
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 602686 | |||||||||||||||||||||||||||||
Literature Links: |
LOC100127955 PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
LOC100127955 - uncharacterized LOC100127955 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAD1L1 - MAD1 mitotic arrest deficient like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013836.1 | Intron | NP_001013858.1 | ||||
NM_001013837.1 | Intron | NP_001013859.1 | ||||
NM_001304523.1 | Intron | NP_001291452.1 | ||||
NM_001304524.1 | Intron | NP_001291453.1 | ||||
NM_001304525.1 | Intron | NP_001291454.1 | ||||
NM_003550.2 | Intron | NP_003541.2 | ||||
XM_005249877.1 | Intron | XP_005249934.1 | ||||
XM_011515567.1 | Intron | XP_011513869.1 | ||||
XM_011515568.2 | Intron | XP_011513870.1 | ||||
XM_011515569.2 | Intron | XP_011513871.2 | ||||
XM_011515571.1 | Intron | XP_011513873.1 | ||||
XM_017012690.1 | Intron | XP_016868179.1 | ||||
XM_017012691.1 | Intron | XP_016868180.1 |
MIR4655 - microRNA 4655 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |