Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGATGTGGATTTCCAAAACATGCAC[A/G]GAAAGGTGAATAGCTCAAGGATACC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 601959 MIM: 610358 | |||||||||||||||||||||||
Literature Links: |
GLT8D1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GLT8D1 - glycosyltransferase 8 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEK4 - NIMA related kinase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193533.1 | 4527 | Intron | NP_001180462.1 | |||
NM_003157.4 | 4527 | Intron | NP_003148.2 | |||
XM_006713310.2 | 4527 | UTR 3 | XP_006713373.1 | |||
XM_011534039.2 | 4527 | Intron | XP_011532341.1 | |||
XM_011534040.2 | 4527 | Intron | XP_011532342.1 | |||
XM_017007085.1 | 4527 | Intron | XP_016862574.1 | |||
XM_017007086.1 | 4527 | Intron | XP_016862575.1 |
SPCS1 - signal peptidase complex subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |