Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGAGAGCGGTGATACTGGGTTAA[A/G]AGTGGAAGGATTGTTTGGAACGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601772 MIM: 609806 MIM: 608549 | ||||||||||||||||||||
Literature Links: |
H2AFX PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
H2AFX - H2A histone family member X | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMBS - hydroxymethylbilane synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000190.3 | Intron | NP_000181.2 | ||||
NM_001024382.1 | Intron | NP_001019553.1 | ||||
NM_001258208.1 | Intron | NP_001245137.1 | ||||
NM_001258209.1 | Intron | NP_001245138.1 | ||||
XM_005271531.1 | Intron | XP_005271588.1 | ||||
XM_005271532.1 | Intron | XP_005271589.1 | ||||
XM_005271533.3 | Intron | XP_005271590.1 | ||||
XM_011542796.1 | Intron | XP_011541098.1 | ||||
XM_017017629.1 | Intron | XP_016873118.1 |
VPS11 - VPS11, CORVET/HOPS core subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |