Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATGCAGCGGGGGCACAGGCCGAG[A/G]CTGGGCAGGGCTGGGACTCTGAGGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
17 submissions
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 146910 MIM: 147070 MIM: 147010 MIM: 147170 MIM: 147020 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
IGH PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
IGH - immunoglobulin heavy locus | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IGHD - immunoglobulin heavy constant delta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IGHM - immunoglobulin heavy constant mu | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4507 - microRNA 4507 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4537 - microRNA 4537 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4538 - microRNA 4538 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4539 - microRNA 4539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |