Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCTCTCGCCGCTTCCCACCCCAG[A/C]CGGAGCGGGGACAGGCTGCCGAGCA
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 604178 MIM: 601843 | |||||||||||||||||||||||||||||
Literature Links: |
RPL18A PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
RPL18A - ribosomal protein L18a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC5A5 - solute carrier family 5 member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000453.2 | 796 | UTR 5 | NP_000444.1 | |||
XM_011528192.2 | 796 | UTR 5 | XP_011526494.1 | |||
XM_011528193.2 | 796 | Intron | XP_011526495.1 | |||
XM_011528194.2 | 796 | Intron | XP_011526496.1 | |||
XM_017027158.1 | 796 | Intron | XP_016882647.1 |
SNORA68 - small nucleolar RNA, H/ACA box 68 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |