Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAAGGACATGTCCCCGGGGATTC[A/G]AATACACTTCTCAAAGTGTACTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603682 | ||||||||||||||||||||
Literature Links: |
LOC105375847 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105375847 - uncharacterized LOC105375847 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS20 - ribosomal protein S20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001023.3 | 600 | Intron | NP_001014.1 | |||
NM_001146227.1 | 600 | Silent Mutation | TTC,TTT | F,F 134 | NP_001139699.1 |
SNORD54 - small nucleolar RNA, C/D box 54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |