Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAAGGGTGACCAAAAGTATATGTA[A/C]CCTGCTTATGAGGGCAGTTCTACCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603099 MIM: 609897 MIM: 603298 MIM: 602677 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
AGPAT1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
AGPAT1 - 1-acylglycerol-3-phosphate O-acyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006411.3 | Intron | NP_006402.1 | ||||
NM_032741.4 | Intron | NP_116130.2 | ||||
XM_005248805.3 | Intron | XP_005248862.1 | ||||
XM_005248806.2 | Intron | XP_005248863.1 | ||||
XM_011514234.1 | Intron | XP_011512536.1 |
EGFL8 - EGF like domain multiple 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6721 - microRNA 6721 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6833 - microRNA 6833 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPT2 - palmitoyl-protein thioesterase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPT2-EGFL8 - PPT2-EGFL8 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF5 - ring finger protein 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |