Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCCACCACGCTCTTCTGCCTGCTG[A/C]ACTTTGGAGTGATCGGCCCCCAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 153440 MIM: 600978 MIM: 191160 | ||||||||||||||||||||
Literature Links: |
LOC100287329 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100287329 - uncharacterized LOC100287329 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LTA - lymphotoxin alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LTB - lymphotoxin beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNF - tumor necrosis factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000594.3 | 329 | Missense Mutation | AAC,CAC | N,H 52 | NP_000585.2 |