Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTGGTCCATCTTGATAATTTCAT[A/G]CTCTGGCTTGGCAAAGACTGAAGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616574 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC105378614 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC105378614 - uncharacterized LOC105378614 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MINOS1 - mitochondrial inner membrane organizing system 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001032363.3 | 265 | Intron | NP_001027535.1 | |||
NM_001204082.1 | 265 | Intron | NP_001191011.1 | |||
NM_001204083.1 | 265 | Intron | NP_001191012.1 |
MINOS1-NBL1 - MINOS1-NBL1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204088.1 | 265 | UTR 5 | NP_001191017.1 | |||
NM_001204089.1 | 265 | Intron | NP_001191018.1 |
RPS14P3 - ribosomal protein S14 pseudogene 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |