Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCTGTCGCTGCGGGGGCCCCGCG[A/C]GGGACTGGCCAGGCTCTTCCATTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600610 | ||||||||||||||||||||
Literature Links: |
FLJ10038 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FLJ10038 - uncharacterized protein FLJ10038 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GABPB1 - GA binding protein transcription factor beta subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320910.1 | Intron | NP_001307839.1 | ||||
NM_001320915.1 | Intron | NP_001307844.1 | ||||
NM_002041.4 | Intron | NP_002032.2 | ||||
NM_005254.5 | Intron | NP_005245.2 | ||||
NM_016654.4 | Intron | NP_057738.1 | ||||
NM_016655.4 | Intron | NP_057739.1 | ||||
NM_181427.3 | Intron | NP_852092.1 | ||||
XM_005254274.3 | Intron | XP_005254331.1 | ||||
XM_011521426.2 | Intron | XP_011519728.1 | ||||
XM_017022053.1 | Intron | XP_016877542.1 | ||||
XM_017022054.1 | Intron | XP_016877543.1 |
GABPB1-AS1 - GABPB1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4712 - microRNA 4712 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |