Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAGCAACTGCGATGGTATAAGAG[T/C]GAGGTCCACCAATCTCCTGCCGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 300300 MIM: 300644 MIM: 300902 | ||||||||||||||||||||
Literature Links: |
BTK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BTK - Bruton tyrosine kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GLA - galactosidase alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000169.2 | 1198 | Missense Mutation | CAC,CGC | H,R 363 | NP_000160.1 |
RPL36A - ribosomal protein L36a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL36A-HNRNPH2 - RPL36A-HNRNPH2 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199973.1 | 1198 | Intron | NP_001186902.1 | |||
NM_001199974.1 | 1198 | Intron | NP_001186903.1 |