Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTAGACAGTGTCTCCGCCAGCCAG[C/G]TAGGCAGCCCAGAAGCCGAAGGTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609436 MIM: 211100 MIM: 609278 MIM: 609623 | ||||||||||||||||||||
Literature Links: |
FGF21 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FGF21 - fibroblast growth factor 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FUT1 - fucosyltransferase 1 (H blood group) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000148.3 | 1923 | Silent Mutation | TAC,TAG | Y,* 316 | NP_000139.1 | |
XM_006723127.2 | 1923 | Silent Mutation | TAC,TAG | Y,* 439 | XP_006723190.1 | |
XM_017026552.1 | 1923 | Silent Mutation | TAC,TAG | Y,* 439 | XP_016882041.1 | |
XM_017026553.1 | 1923 | Silent Mutation | TAC,TAG | Y,* 316 | XP_016882042.1 |
IZUMO1 - izumo sperm-egg fusion 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASIP1 - Ras interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |