Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGGGTTAAAGCGGCTCCGAACAC[G/A]AAACGTGTAGCGTTTCTGCCCATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300033 MIM: 308380 MIM: 300188 | ||||||||||||||||||||
Literature Links: |
CXorf65 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CXorf65 - chromosome X open reading frame 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOXO4 - forkhead box O4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IL2RG - interleukin 2 receptor subunit gamma | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000206.2 | 756 | Missense Mutation | CGT,TGT | R,C 222 | NP_000197.1 |
MED12 - mediator complex subunit 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |