Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGCTGAGTCCATGATGATTTCA[A/C]GTTATCCCTGTCTGAAGGCAAAGAA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608759 MIM: 610598 MIM: 610137 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYGB PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CYGB - cytoglobin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRCD - progressive rod-cone degeneration | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNHG16 - small nucleolar RNA host gene 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1A - small nucleolar RNA, C/D box 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1B - small nucleolar RNA, C/D box 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1C - small nucleolar RNA, C/D box 1C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ST6GALNAC2 - ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |