Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAGAGGACCTTGGGCCCCGTCCT[A/G]GTGACGACGGAGAAGAGGGCCGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608876 | ||||||||||||||||||||
Literature Links: |
ANKRD42 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKRD42 - ankyrin repeat domain 42 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300972.1 | 813 | UTR 5 | NP_001287901.1 | |||
NM_001300973.1 | 813 | UTR 5 | NP_001287902.1 | |||
NM_001300975.1 | 813 | UTR 5 | NP_001287904.1 | |||
NM_001300976.1 | 813 | UTR 5 | NP_001287905.1 | |||
NM_001300977.1 | 813 | UTR 5 | NP_001287906.1 | |||
NM_182603.3 | 813 | UTR 5 | NP_872409.2 |
LOC100506282 - uncharacterized LOC100506282 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCF11 - PCF11 cleavage and polyadenylation factor subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCF11-AS1 - PCF11 anstisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |