Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTTATGGTAGAGAGAAAGAGCGG[C/G]TGCGTCTGGACTAGTTAGTCTCGTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611272 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ZKSCAN5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ZKSCAN5 - zinc finger with KRAB and SCAN domains 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318082.1 | 415 | Intron | NP_001305011.1 | |||
NM_001318083.1 | 415 | Intron | NP_001305012.1 | |||
NM_001318084.1 | 415 | Intron | NP_001305013.1 | |||
NM_014569.3 | 415 | Intron | NP_055384.1 | |||
NM_145102.3 | 415 | Intron | NP_659570.1 | |||
XM_011515999.2 | 415 | Intron | XP_011514301.1 | |||
XM_017011918.1 | 415 | Intron | XP_016867407.1 | |||
XM_017011919.1 | 415 | Intron | XP_016867408.1 | |||
XM_017011920.1 | 415 | UTR 5 | XP_016867409.1 | |||
XM_017011921.1 | 415 | Intron | XP_016867410.1 | |||
XM_017011922.1 | 415 | Intron | XP_016867411.1 | |||
XM_017011923.1 | 415 | Intron | XP_016867412.1 | |||
XM_017011924.1 | 415 | Intron | XP_016867413.1 | |||
XM_017011925.1 | 415 | Intron | XP_016867414.1 | |||
XM_017011926.1 | 415 | Intron | XP_016867415.1 | |||
XM_017011927.1 | 415 | Intron | XP_016867416.1 |
ZNF394 - zinc finger protein 394 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |