Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGCGACGGCCCGGAAGGAAGTCG[C/T]GTGCTGAGGGGTGTGACGGTTTTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611605 | ||||||||||||||||||||
Literature Links: |
ERLIN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ERLIN2 - ER lipid raft associated 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003790.3 | 29 | Intron | NP_001003790.1 | |||
NM_001003791.2 | 29 | UTR 5 | NP_001003791.1 | |||
NM_007175.6 | 29 | UTR 5 | NP_009106.1 | |||
XM_005273392.2 | 29 | Intron | XP_005273449.1 | |||
XM_006716280.2 | 29 | Intron | XP_006716343.1 | |||
XM_017013000.1 | 29 | Intron | XP_016868489.1 |
LOC101929622 - uncharacterized LOC101929622 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102723701 - uncharacterized LOC102723701 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC728024 - chromosome X open reading frame 56 pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |