Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACAGACAGCATCCGCAGTCAATAG[G/A]AAGAGCTGAAGAATTCTTTAGGTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612897 MIM: 613620 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC107983970 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC107983970 - uncharacterized LOC107983970 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011546022.2 | 37 | Intron | XP_011544324.1 |
MYLPF - myosin light chain, phosphorylatable, fast skeletal muscle | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001324458.1 | 37 | Intron | NP_001311387.1 | |||
NM_001324459.1 | 37 | UTR 5 | NP_001311388.1 | |||
NM_013292.4 | 37 | Intron | NP_037424.2 |
SEPT1 - septin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D10B - TBC1 domain family member 10B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015527.3 | 37 | Intron | NP_056342.3 | |||
XM_011545789.1 | 37 | Intron | XP_011544091.1 | |||
XM_011545790.2 | 37 | Intron | XP_011544092.1 |
ZNF48 - zinc finger protein 48 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |