Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCCGCGCCGGGGACAGTCAGGGAT[G/T]CTCCCAGGCCCTTCGCTCTTGCTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616820 | ||||||||||||||||||||
Literature Links: |
FLJ30679 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FLJ30679 - uncharacterized protein FLJ30679 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOXC2-AS1 - FOXC2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTHFSD - methenyltetrahydrofolate synthetase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159377.1 | Intron | NP_001152849.1 | ||||
NM_001159378.1 | Intron | NP_001152850.1 | ||||
NM_001159379.1 | Intron | NP_001152851.1 | ||||
NM_001159380.1 | Intron | NP_001152852.1 | ||||
NM_022764.2 | Intron | NP_073601.2 | ||||
XM_005256101.1 | Intron | XP_005256158.1 | ||||
XM_005256105.1 | Intron | XP_005256162.1 | ||||
XM_005256106.1 | Intron | XP_005256163.1 | ||||
XM_006721247.3 | Intron | XP_006721310.1 | ||||
XM_011523280.2 | Intron | XP_011521582.1 | ||||
XM_011523282.2 | Intron | XP_011521584.1 | ||||
XM_011523283.2 | Intron | XP_011521585.1 | ||||
XM_011523284.2 | Intron | XP_011521586.1 | ||||
XM_011523285.1 | Intron | XP_011521587.1 | ||||
XM_011523286.1 | Intron | XP_011521588.1 | ||||
XM_011523287.1 | Intron | XP_011521589.1 | ||||
XM_011523288.1 | Intron | XP_011521590.1 | ||||
XM_011523289.1 | Intron | XP_011521591.1 | ||||
XM_017023571.1 | Intron | XP_016879060.1 | ||||
XM_017023572.1 | Intron | XP_016879061.1 | ||||
XM_017023573.1 | Intron | XP_016879062.1 | ||||
XM_017023574.1 | Intron | XP_016879063.1 |