Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTTGAAGGTCACACCTGTTTGTCT[C/T]ACTGGGGTTGTCAGTTCCTCGAGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
37 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKMY2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EUR
|
African American - Not Available | YRI (Yoruba)
|
||||||
EAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
||||||
SAS - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
||||||
AFR - Not Available | ||||||||
ANKMY2 - ankyrin repeat and MYND domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BZW2 - basic leucine zipper and W2 domains 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159767.1 | Intron | NP_001153239.1 | ||||
NM_014038.2 | Intron | NP_054757.1 | ||||
XM_006715706.1 | Intron | XP_006715769.1 | ||||
XM_006715707.1 | Intron | XP_006715770.1 | ||||
XM_006715708.1 | Intron | XP_006715771.1 |
Set Membership: |
HapMap |