Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCACTTGCAGCTGCCGATGTGGCT[A/G]GATCTGGAACTTCTCAGACGGCTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 118495 MIM: 601441 MIM: 162096 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHRM4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHRM4 - cholinergic receptor muscarinic 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DGKZ - diacylglycerol kinase zeta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001105540.1 | 25 | Intron | NP_001099010.1 | |||
NM_001199266.1 | 25 | Intron | NP_001186195.1 | |||
NM_001199267.1 | 25 | Intron | NP_001186196.1 | |||
NM_001199268.1 | 25 | Intron | NP_001186197.1 | |||
NM_003646.3 | 25 | Intron | NP_003637.2 | |||
NM_201532.2 | 25 | Intron | NP_963290.1 | |||
NM_201533.3 | 25 | Intron | NP_963291.2 | |||
XM_005253181.3 | 25 | Intron | XP_005253238.1 | |||
XM_005253182.3 | 25 | Intron | XP_005253239.1 | |||
XM_006718354.1 | 25 | Intron | XP_006718417.1 | |||
XM_006718355.2 | 25 | Intron | XP_006718418.1 | |||
XM_011520422.1 | 25 | Intron | XP_011518724.1 | |||
XM_011520423.1 | 25 | Intron | XP_011518725.1 | |||
XM_017018455.1 | 25 | Intron | XP_016873944.1 | |||
XM_017018456.1 | 25 | Intron | XP_016873945.1 | |||
XM_017018457.1 | 25 | Intron | XP_016873946.1 |
MDK - midkine (neurite growth-promoting factor 2) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012333.2 | 25 | Intron | NP_001012333.1 | |||
NM_001012334.2 | 25 | Intron | NP_001012334.1 | |||
NM_001270550.1 | 25 | UTR 5 | NP_001257479.1 | |||
NM_001270551.1 | 25 | Intron | NP_001257480.1 | |||
NM_001270552.1 | 25 | Intron | NP_001257481.1 | |||
NM_002391.4 | 25 | Intron | NP_002382.1 | |||
XM_011520116.2 | 25 | UTR 5 | XP_011518418.1 | |||
XM_017017764.1 | 25 | Intron | XP_016873253.1 |
MIR4688 - microRNA 4688 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |