Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCCTTCCACCCACCCCAGCTCT[A/G]TGTCTGTGTCTGAATTGTGGATCGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602539 MIM: 608626 | ||||||||||||||||||||
Literature Links: |
LIMD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LIMD2 - LIM domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030576.3 | 4575 | UTR 3 | NP_085053.1 |
LOC729683 - uncharacterized LOC729683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K3 - mitogen-activated protein kinase kinase kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002401.3 | 4575 | UTR 3 | NP_002392.2 | |||
NM_203351.1 | 4575 | UTR 3 | NP_976226.1 |
STRADA - STE20-related kinase adaptor alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |