Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACCATCTTGCTCCACACACCCT[A/G]GCCCCCTCTTCCCATAGGCAGGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609575 MIM: 602887 MIM: 602151 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACADVL PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACADVL - acyl-CoA dehydrogenase, very long chain | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000018.3 | 1030 | Intron | NP_000009.1 | |||
NM_001033859.2 | 1030 | Intron | NP_001029031.1 | |||
NM_001270447.1 | 1030 | Intron | NP_001257376.1 | |||
NM_001270448.1 | 1030 | Intron | NP_001257377.1 | |||
XM_006721516.2 | 1030 | Intron | XP_006721579.2 | |||
XM_011523829.1 | 1030 | Intron | XP_011522131.1 | |||
XM_011523830.1 | 1030 | Intron | XP_011522132.1 |
DLG4 - discs large MAGUK scaffold protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128827.2 | 1030 | Intron | NP_001122299.1 | |||
NM_001321074.1 | 1030 | UTR 5 | NP_001308003.1 | |||
NM_001321075.1 | 1030 | Intron | NP_001308004.1 | |||
NM_001321076.1 | 1030 | Intron | NP_001308005.1 | |||
NM_001321077.1 | 1030 | Intron | NP_001308006.1 | |||
NM_001365.4 | 1030 | UTR 5 | NP_001356.1 | |||
XM_005256491.1 | 1030 | Intron | XP_005256548.1 | |||
XM_011523698.1 | 1030 | UTR 5 | XP_011522000.1 | |||
XM_011523699.2 | 1030 | Intron | XP_011522001.1 | |||
XM_011523702.1 | 1030 | Intron | XP_011522004.1 | |||
XM_017024288.1 | 1030 | Intron | XP_016879777.1 | |||
XM_017024289.1 | 1030 | Intron | XP_016879778.1 | |||
XM_017024290.1 | 1030 | Intron | XP_016879779.1 |
DVL2 - dishevelled segment polarity protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR324 - microRNA 324 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |