Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAACAGTCAAAAGGTTTTCTTCAT[C/T]TCATGCAAAGATTGTAGTTGAAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616157 MIM: 131560 | ||||||||||||||||||||
Literature Links: |
DHRS13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DHRS13 - dehydrogenase/reductase 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FLOT2 - flotillin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHF12 - PHD finger protein 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001033561.1 | 3675 | UTR 3 | NP_001028733.1 | |||
NM_001290131.1 | 3675 | Intron | NP_001277060.1 | |||
NM_020889.2 | 3675 | Intron | NP_065940.1 |