Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACTCGCTGCGTCGCTTCCTCTTCT[C/T]GCGCTGAGTTAGCCCCGGGGGCGCC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 600508 | |||||||||||||||||||||||
Literature Links: |
NCK1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
NCK1 - NCK adaptor protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190796.2 | Intron | NP_001177725.1 | ||||
NM_001291999.1 | Intron | NP_001278928.1 | ||||
NM_006153.5 | Intron | NP_006144.1 |
NCK1-AS1 - NCK1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC35G2 - solute carrier family 35 member G2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |