Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTCAGGCTCGGGTGCAATCCGTA[A/C]CCTCAGTGGGTTCCCTTTCAGTGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610195 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR4749 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR4749 - microRNA 4749 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTOV1 - prostate tumor overexpressed 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001305105.1 | 39 | Intron | NP_001292034.1 | |||
NM_001305108.1 | 39 | Intron | NP_001292037.1 | |||
NM_017432.4 | 39 | Intron | NP_059128.2 | |||
XM_005258998.4 | 39 | UTR 5 | XP_005259055.1 | |||
XM_006723244.3 | 39 | UTR 5 | XP_006723307.1 | |||
XM_011527033.1 | 39 | Intron | XP_011525335.1 | |||
XM_011527034.2 | 39 | UTR 5 | XP_011525336.1 | |||
XM_011527035.1 | 39 | Intron | XP_011525337.1 | |||
XM_017026879.1 | 39 | UTR 5 | XP_016882368.1 | |||
XM_017026880.1 | 39 | Intron | XP_016882369.1 |
PTOV1-AS1 - PTOV1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTOV1-AS2 - PTOV1 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |