Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACCCTGTCCGGGCCTCAGCCCCC[A/C]GCCTCTGCCCACATTCTCTTCGTGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 601281 | |||||||||||||||||||||||
Literature Links: |
LSMEM2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LSMEM2 - leucine rich single-pass membrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6872 - microRNA 6872 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEMA3B - semaphorin 3B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005914.2 | Intron | NP_001005914.1 | ||||
NM_001290060.1 | Intron | NP_001276989.1 | ||||
NM_001290061.1 | Intron | NP_001276990.1 | ||||
NM_001290062.1 | Intron | NP_001276991.1 | ||||
NM_001290063.1 | Intron | NP_001276992.1 | ||||
NM_004636.3 | Intron | NP_004627.1 |
SEMA3B-AS1 - SEMA3B antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |