Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGCCGCACCTGGCTCAGGCTGC[A/C]CCTCAAAATGTGTTAGGATCTGGAA
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609506 MIM: 613336 MIM: 604466 MIM: 615258 | ||||||||||||||||||||||||||||||||
Literature Links: |
CYP27B1 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CYP27B1 - cytochrome P450 family 27 subfamily B member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000785.3 | 1585 | Missense Mutation | GGG,GTG | G,V 478 | NP_000776.1 |
MARCH9 - membrane associated ring-CH-type finger 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL1 - methyltransferase like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL21B - methyltransferase like 21B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
DME Validated Inventoried |