Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCATCTTCTTCCTGCTCAGCGCCA[G/T]CATCATCCCCAATGGCTTCACCGGC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603377 | ||||||||||||||||||||||||||||||||
Literature Links: |
LOC553103 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LOC553103 - uncharacterized LOC553103 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3936 - microRNA 3936 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC22A5 - solute carrier family 22 member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308122.1 | 347 | Missense Mutation | AGC,ATC | S,I 28 | NP_001295051.1 | |
NM_003060.3 | 347 | Missense Mutation | AGC,ATC | S,I 28 | NP_003051.1 | |
XM_011543590.2 | 347 | Intron | XP_011541892.1 | |||
XM_017009778.1 | 347 | Intron | XP_016865267.1 |
Set Membership: |
DME Validated Inventoried |