Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGAGGTTTCTGATGGAACTTATGG[C/G]GACAGTTGGAAGTGGGGCCGTGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611184 | ||||||||||||||||||||
Literature Links: |
CTU2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTU2 - cytosolic thiouridylase subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012759.2 | Intron | NP_001012777.1 | ||||
NM_001012762.2 | Intron | NP_001012780.1 | ||||
NM_001318507.1 | Intron | NP_001305436.1 | ||||
NM_001318513.1 | Intron | NP_001305442.1 |
MIR4722 - microRNA 4722 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIEZO1 - piezo type mechanosensitive ion channel component 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF166 - ring finger protein 166 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |