Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTCTATTTGTTCATATGGCAACA[C/T]ACTGGGAAGTTTGGCGCTATTAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600410 | ||||||||||||||||||||
Literature Links: |
LOC101929319 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101929319 - uncharacterized LOC101929319 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4773-1 - microRNA 4773-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4773-2 - microRNA 4773-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP6 - TNF alpha induced protein 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007115.3 | Intron | NP_009046.2 |