Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTTAGATCCTAAAAATCATCCCC[C/T]GAGACATCCTGCCGTATCTTTGTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603322 MIM: 609507 | ||||||||||||||||||||
Literature Links: |
NDUFB6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NDUFB6 - NADH:ubiquinone oxidoreductase subunit B6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199987.1 | Intron | NP_001186916.1 | ||||
NM_002493.4 | Intron | NP_002484.1 | ||||
NM_182739.2 | Intron | NP_877416.1 |
TOPORS - TOP1 binding arginine/serine rich protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOPORS-AS1 - TOPORS antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |