Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTACCTCATCAAGTTTACAGAAAGC[A/C]TGTTCCCAACCAGGAAAATAATTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 186945 | ||||||||||||||||||||
Literature Links: |
FKBP1A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FKBP1A - FK506 binding protein 1A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000801.4 | Intron | NP_000792.1 | ||||
NM_001199786.1 | Intron | NP_001186715.1 | ||||
NM_054014.3 | Intron | NP_463460.1 |
FKBP1A-SDCBP2 - FKBP1A-SDCBP2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SDCBP2-AS1 - SDCBP2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |