Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATAAGAACATTAACTACTCCCCA[C/G]CAGTTTATATTATTCTTTGCATGAA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609204 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CFAP70 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CFAP70 - cilia and flagella associated protein 70 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145170.3 | Intron | NP_660153.3 | ||||
XM_005269489.2 | Intron | XP_005269546.1 | ||||
XM_006717604.2 | Intron | XP_006717667.1 | ||||
XM_006717605.2 | Intron | XP_006717668.1 | ||||
XM_006717609.2 | Intron | XP_006717672.1 | ||||
XM_006717610.2 | Intron | XP_006717673.1 | ||||
XM_006717611.3 | Intron | XP_006717674.1 | ||||
XM_011539212.2 | Intron | XP_011537514.1 | ||||
XM_017015620.1 | Intron | XP_016871109.1 | ||||
XM_017015621.1 | Intron | XP_016871110.1 | ||||
XM_017015622.1 | Intron | XP_016871111.1 | ||||
XM_017015623.1 | Intron | XP_016871112.1 | ||||
XM_017015624.1 | Intron | XP_016871113.1 | ||||
XM_017015625.1 | Intron | XP_016871114.1 | ||||
XM_017015626.1 | Intron | XP_016871115.1 | ||||
XM_017015627.1 | Intron | XP_016871116.1 | ||||
XM_017015628.1 | Intron | XP_016871117.1 | ||||
XM_017015629.1 | Intron | XP_016871118.1 | ||||
XM_017015630.1 | Intron | XP_016871119.1 | ||||
XM_017015631.1 | Intron | XP_016871120.1 | ||||
XM_017015632.1 | Intron | XP_016871121.1 | ||||
XM_017015633.1 | Intron | XP_016871122.1 |
DNAJC9-AS1 - DNAJC9 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS16 - mitochondrial ribosomal protein S16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |