Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAGATGAGCTGTTGGCTTCTTGCA[C/G]TGAGTCAAAGGTCCCATCTGTCTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607513 | ||||||||||||||||||||
Literature Links: |
ADAMTS19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAMTS19 - ADAM metallopeptidase with thrombospondin type 1 motif 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011543246.2 | Intron | XP_011541548.1 | ||||
XM_011543247.2 | Intron | XP_011541549.1 | ||||
XM_011543248.2 | Intron | XP_011541550.1 | ||||
XM_011543249.2 | Intron | XP_011541551.1 | ||||
XM_017009174.1 | Intron | XP_016864663.1 | ||||
XM_017009175.1 | Intron | XP_016864664.1 | ||||
XM_017009176.1 | Intron | XP_016864665.1 |
ADAMTS19-AS1 - ADAMTS19 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |