Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACTATAAGCTTTCTCTAGAAGT[G/T]GAAAAAGCCTATCTGGATTATGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600153 MIM: 605857 | ||||||||||||||||||||
Literature Links: |
LOC100506142 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100506142 - uncharacterized LOC100506142 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGF - phosphatidylinositol glycan anchor biosynthesis class F | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002643.3 | Intron | NP_002634.1 | ||||
NM_173074.2 | Intron | NP_775097.1 | ||||
XM_005264369.2 | Intron | XP_005264426.1 | ||||
XM_011532908.2 | Intron | XP_011531210.1 |
RHOQ - ras homolog family member Q | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |