Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATTTTCAGTTAGCTGAGGACAGGG[A/G]AGTGCCAAGGGTGATGGGGAAGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605436 | ||||||||||||||||||||
Literature Links: |
SNORD116-1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SNORD116-1 - small nucleolar RNA, C/D box 116-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-2 - small nucleolar RNA, C/D box 116-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-3 - small nucleolar RNA, C/D box 116-3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-4 - small nucleolar RNA, C/D box 116-4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-5 - small nucleolar RNA, C/D box 116-5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-6 - small nucleolar RNA, C/D box 116-6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-7 - small nucleolar RNA, C/D box 116-7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116@ - small nucleolar RNA, C/D box 116 cluster | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |