Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGACTTGATAGGGAGGTCACATCC[A/G]GAGCTGGAACAGCCCATCAATGTAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610384 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
HECW1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
HECW1 - HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287059.1 | Intron | NP_001273988.1 | ||||
NM_015052.4 | Intron | NP_055867.3 | ||||
XM_005249665.3 | Intron | XP_005249722.1 | ||||
XM_006715670.3 | Intron | XP_006715733.1 | ||||
XM_006715671.3 | Intron | XP_006715734.1 | ||||
XM_006715673.3 | Intron | XP_006715736.1 | ||||
XM_011515220.2 | Intron | XP_011513522.1 | ||||
XM_011515222.2 | Intron | XP_011513524.1 | ||||
XM_011515223.2 | Intron | XP_011513525.1 | ||||
XM_011515224.2 | Intron | XP_011513526.1 | ||||
XM_011515225.2 | Intron | XP_011513527.2 | ||||
XM_011515226.2 | Intron | XP_011513528.1 | ||||
XM_017011882.1 | Intron | XP_016867371.1 | ||||
XM_017011883.1 | Intron | XP_016867372.1 | ||||
XM_017011884.1 | Intron | XP_016867373.1 | ||||
XM_017011885.1 | Intron | XP_016867374.1 | ||||
XM_017011886.1 | Intron | XP_016867375.1 | ||||
XM_017011887.1 | Intron | XP_016867376.1 | ||||
XM_017011888.1 | Intron | XP_016867377.1 | ||||
XM_017011889.1 | Intron | XP_016867378.1 | ||||
XM_017011890.1 | Intron | XP_016867379.1 |
HECW1-IT1 - HECW1 intronic transcript 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105375254 - uncharacterized LOC105375254 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_017012919.1 | Intron | XP_016868408.1 |
Set Membership: |
HapMap |