Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTACGATGTACATAAACTCTCGAG[A/G]ACAAATACTACTAATCACTTACGCC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603661 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C18orf32 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
C18orf32 - chromosome 18 open reading frame 32 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001035005.3 | Intron | NP_001030177.1 | ||||
NM_001199346.1 | Intron | NP_001186275.1 |
MIR1539 - microRNA 1539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL17 - ribosomal protein L17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL17-C18orf32 - RPL17-C18orf32 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199355.1 | Intron | NP_001186284.1 | ||||
NM_001199356.1 | Intron | NP_001186285.1 |
SNORD58A - small nucleolar RNA, C/D box 58A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58B - small nucleolar RNA, C/D box 58B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58C - small nucleolar RNA, C/D box 58C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |