Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGAACTTGACTTCTCGCGAGATTC[C/G]TAGCCGAAGAAACGAGATCTGAGGA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603661 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C18orf32 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
C18orf32 - chromosome 18 open reading frame 32 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928144 - uncharacterized LOC101928144 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1539 - microRNA 1539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL17 - ribosomal protein L17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000985.4 | 32 | UTR 5 | NP_000976.1 | |||
NM_001035006.2 | 32 | Intron | NP_001030178.1 | |||
NM_001199340.1 | 32 | Intron | NP_001186269.1 | |||
NM_001199341.1 | 32 | Intron | NP_001186270.1 | |||
NM_001199342.1 | 32 | Intron | NP_001186271.1 | |||
NM_001199343.1 | 32 | Intron | NP_001186272.1 | |||
NM_001199344.1 | 32 | Intron | NP_001186273.1 | |||
NM_001199345.1 | 32 | Intron | NP_001186274.1 |
RPL17-C18orf32 - RPL17-C18orf32 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199355.1 | 32 | Intron | NP_001186284.1 | |||
NM_001199356.1 | 32 | UTR 5 | NP_001186285.1 |
SNORD58A - small nucleolar RNA, C/D box 58A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58B - small nucleolar RNA, C/D box 58B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58C - small nucleolar RNA, C/D box 58C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |