Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTAGGTGCATGTGGAGGCCGCTCGG[G/T]TGGTTCGCGCCTGCTGCAGGGCACG
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605522 MIM: 610241 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LMBR1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
LMBR1 - limb development membrane protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927858 - uncharacterized LOC101927858 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF32 - ring finger protein 32 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184996.1 | Intron | NP_001171925.1 | ||||
NM_001184997.1 | Intron | NP_001171926.1 | ||||
NM_001308273.1 | Intron | NP_001295202.1 | ||||
NM_001308274.1 | Intron | NP_001295203.1 | ||||
NM_030936.3 | Intron | NP_112198.1 | ||||
XM_005249522.4 | Intron | XP_005249579.1 | ||||
XM_011515804.2 | Intron | XP_011514106.1 | ||||
XM_011515805.2 | Intron | XP_011514107.1 | ||||
XM_011515806.2 | Intron | XP_011514108.1 | ||||
XM_011515807.2 | Intron | XP_011514109.1 | ||||
XM_011515808.2 | Intron | XP_011514110.1 | ||||
XM_011515809.2 | Intron | XP_011514111.1 | ||||
XM_011515810.2 | Intron | XP_011514112.1 | ||||
XM_011515811.2 | Intron | XP_011514113.1 | ||||
XM_011515812.2 | Intron | XP_011514114.1 | ||||
XM_011515813.2 | Intron | XP_011514115.1 | ||||
XM_017011753.1 | Intron | XP_016867242.1 | ||||
XM_017011754.1 | Intron | XP_016867243.1 | ||||
XM_017011755.1 | Intron | XP_016867244.1 |